0 comments Details Oncomelania hupensis quadrasi Genus: Oncomelania Species: hupensis quadrasi Common Name: Genbank Taxid: 1454754 Group: Mollusk Habitat: Freshwater Status: Gene Region: COI Fragment Length: 187 qPCR Chemistry: TaqMan Forward Primer: GCATGTGAGCGGGGCTAGTA Reverse Primer: AAGCGGAACCAATCAGTTGCC Probe: 5’–FAM–GTGCAGAGTTAGGTCAGTCCT–MGB–NFQ–3’ PCR Efficiency: – R2: – Limit of Detection: – Limit of Quantification: – Journal: Pathogens Source: Calata et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.