Details

Oncomelania hupensis quadrasi

Genus:

Oncomelania

Species:

hupensis quadrasi

Common Name:

Genbank Taxid:

1454754

Group:

Mollusk

Habitat:

Freshwater

Status:

Gene Region:

COI

Fragment Length:

187

qPCR Chemistry:

TaqMan

Forward Primer:

GCATGTGAGCGGGGCTAGTA

Reverse Primer:

AAGCGGAACCAATCAGTTGCC

Probe:

5’–FAM–GTGCAGAGTTAGGTCAGTCCT–MGB–NFQ–3’

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Pathogens