Details

Dikerogammarus haemobaphes

Genus:

Dikerogammarus

Species:

haemobaphes

Common Name:

Genbank Taxid:

191520

Group:

Crusteacean

Habitat:

Freshwater

Status:

Invasvie

Gene Region:

COI

Fragment Length:

117

qPCR Chemistry:

TaqMan

Forward Primer:

5’ – GGAGCTTCCTCTATTCTTGGCGCAATT – 3’

Reverse Primer:

5’ – GGCCGTGATAAAGACAGACCAGACAAA – 3’

Probe:

6–FAM – TTCTTAATATGCGCGCCCCAGGC – BHQ–1

PCR Efficiency:

90.341

R2:

0.937

Limit of Detection:

4.923 pg DNA / reaction at 38.236 ± 0.915Ct

Limit of Quantification:

49.23 pg DNA / reaction at 34.90 ± 0.690 Ct

Journal:

Management of Biological Invasions