Details

Isogenus nubecula

Genus:

Isogenus

Species:

nubecula

Common Name:

Genbank Taxid:

2069595

Group:

Insect

Habitat:

Freshwater

Status:

Endangered

Gene Region:

COI

Fragment Length:

124

qPCR Chemistry:

PrecisionPlus qPCR Master Mix with ROX

Forward Primer:

5′–CCAGAAGCCTTGTAGAAAAC–3′

Reverse Primer:

5′–ACCCCGGCTAGATGAAGAGA–3′

Probe:

6–FAM–CCCCACTCTCTGCTGGAATT–BHQ–1

PCR Efficiency:

R2:

Limit of Detection:

2.046 x 10e–5 ng DNA / reaction at 39.29 ± 2.00 Ct

Limit of Quantification:

0.002046 ng DNA / reaction at at 34.48 ± 0.95 Ct

Journal:

Scientific Reports