0 comments Details Isogenus nubecula Genus: Isogenus Species: nubecula Common Name: Genbank Taxid: 2069595 Group: Insect Habitat: Freshwater Status: Endangered Gene Region: COI Fragment Length: 124 qPCR Chemistry: PrecisionPlus qPCR Master Mix with ROX Forward Primer: 5′–CCAGAAGCCTTGTAGAAAAC–3′ Reverse Primer: 5′–ACCCCGGCTAGATGAAGAGA–3′ Probe: 6–FAM–CCCCACTCTCTGCTGGAATT–BHQ–1 PCR Efficiency: – R2: – Limit of Detection: 2.046 x 10e–5 ng DNA / reaction at 39.29 ± 2.00 Ct Limit of Quantification: 0.002046 ng DNA / reaction at at 34.48 ± 0.95 Ct Journal: Scientific Reports Source: Mauvisseau et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.