Details

Undaria pinnatifida

Genus:

Undaria

Species:

pinnatifida

Common Name:

Genbank Taxid:

74381

Group:

Algae

Habitat:

Marine

Status:

Gene Region:

COI

Fragment Length:

235

qPCR Chemistry:

SYBR Green

Forward Primer:

5’‐ACGGTATACCCTCCGCTTAGT‐3′

Reverse Primer:

5’‐CACCTGCTAAAACCGGCAA‐3′

Probe:

PCR Efficiency:

109.68

R2:

0.999

Limit of Detection:

Limit of Quantification:

Journal:

Phycological Research