0 comments Details Undaria pinnatifida Genus: Undaria Species: pinnatifida Common Name: Genbank Taxid: 74381 Group: Algae Habitat: Marine Status: Gene Region: COI Fragment Length: 235 qPCR Chemistry: SYBR Green Forward Primer: 5’‐ACGGTATACCCTCCGCTTAGT‐3′ Reverse Primer: 5’‐CACCTGCTAAAACCGGCAA‐3′ Probe: – PCR Efficiency: 109.68 R2: 0.999 Limit of Detection: – Limit of Quantification: – Journal: Phycological Research Source: Nagasato et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.