Details

Saccharina japonica

Genus:

Saccharina

Species:

japonica

Common Name:

Genbank Taxid:

88149

Group:

Algae

Habitat:

Marine

Status:

Gene Region:

COI

Fragment Length:

92

qPCR Chemistry:

SYBR Green

Forward Primer:

5’‐TGCGGTGCCTACAGGT ‐3′

Reverse Primer:

5’‐CAATTGAGAATAGCATGGGGGT‐3′

Probe:

PCR Efficiency:

99.67

R2:

0.997

Limit of Detection:

Limit of Quantification:

Journal:

Phycological Research