Details

Aphanomyces astaci

Genus:

Aphanomyces

Species:

astaci

Common Name:

Genbank Taxid:

112090

Group:

Oomycete

Habitat:

Freshwater

Status:

Parasite

Gene Region:

ITS

Fragment Length:

qPCR Chemistry:

TaqMan

Forward Primer:

5′–AAGGCTTGTGCTGGGATGTT–3′

Reverse Primer:

5′–CTTCTTGCGAAACCTTCTGCTA–3′

Probe:

5′–6–FAM–TTCGGGACGACCC–MGBNFQ–3′

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Journal of Invertebrate Pathology