Details

Alburnoides bipunctatus

Genus:

Alburnoides

Species:

bipunctatus

Common Name:

Genbank Taxid:

58321

Group:

Fish

Habitat:

Freshwater

Status:

Gene Region:

Cytb

Fragment Length:

63

qPCR Chemistry:

TaqMan

Forward Primer:

5`–GGGCGCCACCGTCAT–3′

Reverse Primer:

5′–TGAACAAGTATGTCTCCCATGTAAGG–3′

Probe:

6FAM–CGA ATC TCC TTT CAG CAG T–MGBNFQ

PCR Efficiency:

93

R2:

1

Limit of Detection:

30.310 Ct, 0.01 pg µl− 1

Limit of Quantification:

38.042 cycle threshold Ct, 0.1 pg µl− 1

Journal:

Conservation Genetics Resources