0 comments Details Alburnoides bipunctatus Genus: Alburnoides Species: bipunctatus Common Name: Genbank Taxid: 58321 Group: Fish Habitat: Freshwater Status: Gene Region: Cytb Fragment Length: 63 qPCR Chemistry: TaqMan Forward Primer: 5`–GGGCGCCACCGTCAT–3′ Reverse Primer: 5′–TGAACAAGTATGTCTCCCATGTAAGG–3′ Probe: 6FAM–CGA ATC TCC TTT CAG CAG T–MGBNFQ PCR Efficiency: 93 R2: 1 Limit of Detection: 30.310 Ct, 0.01 pg µl− 1 Limit of Quantification: 38.042 cycle threshold Ct, 0.1 pg µl− 1 Journal: Conservation Genetics Resources Source: Riaz et al. 2018 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.