Details

Recurvirostra avosetta

Genus:

Recurvirostra

Species:

avosetta

Common Name:

Genbank Taxid:

171275

Group:

Bird

Habitat:

Status:

Protected

Gene Region:

COI

Fragment Length:

199

qPCR Chemistry:

SYBR Green

Forward Primer:

AGGGACCCTACTAGGAGATGACCAAATC

Reverse Primer:

TAGGAATGATGGTGGTAATAGTCAAAAG

Probe:

PCR Efficiency:

1.97

R2:

0.8464

Limit of Detection:

42.31 Ct, 0.01 pg μl − 1

Limit of Quantification:

Journal:

Conservation Genetics Resources