0 comments Details Recurvirostra avosetta Genus: Recurvirostra Species: avosetta Common Name: Genbank Taxid: 171275 Group: Bird Habitat: Status: Protected Gene Region: COI Fragment Length: 199 qPCR Chemistry: SYBR Green Forward Primer: AGGGACCCTACTAGGAGATGACCAAATC Reverse Primer: TAGGAATGATGGTGGTAATAGTCAAAAG Probe: – PCR Efficiency: 1.97 R2: 0.8464 Limit of Detection: 42.31 Ct, 0.01 pg μl − 1 Limit of Quantification: – Journal: Conservation Genetics Resources Source: Schütz et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.