Details

Tringa totanus

Genus:

Tringa

Species:

totanus

Common Name:

Genbank Taxid:

171271

Group:

Bird

Habitat:

Status:

Protected

Gene Region:

COI

Fragment Length:

188

qPCR Chemistry:

SYBR Green

Forward Primer:

CCCGTATAAATAACATAAGCTTT

Reverse Primer:

AGAAGAGACACCTGCCAAATGGAGA

Probe:

PCR Efficiency:

1.84

R2:

1

Limit of Detection:

39.72 Ct, 0.01 pg μl − 1

Limit of Quantification:

Journal:

Conservation Genetics Resources