0 comments Details Tringa totanus Genus: Tringa Species: totanus Common Name: Genbank Taxid: 171271 Group: Bird Habitat: Status: Protected Gene Region: COI Fragment Length: 188 qPCR Chemistry: SYBR Green Forward Primer: CCCGTATAAATAACATAAGCTTT Reverse Primer: AGAAGAGACACCTGCCAAATGGAGA Probe: – PCR Efficiency: 1.84 R2: 1 Limit of Detection: 39.72 Ct, 0.01 pg μl − 1 Limit of Quantification: – Journal: Conservation Genetics Resources Source: Schütz et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.