0 comments Details Aphanomyces astaci Genus: Aphanomyces Species: astaci Common Name: Genbank Taxid: 112090 Group: Oomycete Habitat: Freshwater Status: Parasite Gene Region: ITS Fragment Length: 58 qPCR Chemistry: TaqMan Forward Primer: AAGGCTTGTGCTGGGATGTT Reverse Primer: CTTCTTGCGAAACCTTCTGCTA Probe: FAM‐TTCGGGACGACCC‐MGBNFQ PCR Efficiency: – R2: – Limit of Detection: – Limit of Quantification: – Journal: Journal of Applied Ecology Source: Strand et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.