0 comments Details Genus:Dactylogyrus Species:intermedius Common Name: Genbank Taxid: Group:parasite Habitat:Freshwater Status:Parasite Gene Region:ITS-1 Fragment Length:210 qPCR Chemistry:Dye Forward Primer:TCAGAATCTGAACCCTATCCAATAC Reverse Primer:TGCCGCACGACACGTTA Probe:N/A PCR Efficiency:104.6 R2: Limit of Detection:1.32E-07 ng/ul Limit of Quantification:N/A Journal:Scientific Reports Source: https://www.nature.com/articles/s41598-019-41517-2 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.