0 comments Details Genus:Lampetra Species:spp. Common Name: Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:native Gene Region:CYTB Fragment Length:126 qPCR Chemistry:Probe Forward Primer:CTTTAGCAGCAGCCATCATA Reverse Primer:GTAGTGCTAGATCAGCAATTAGAA Probe:CATTCAATTTCGTCCGC PCR Efficiency:90.43 R2: Limit of Detection:1 copy/reaction Limit of Quantification:6 copies/reaction Journal:PeerJ Source: https://peerj.com/articles/4496 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
