0 comments Details Genus:Mytilopsis Species:leucophaeata Common Name: Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:193 qPCR Chemistry:Probe Forward Primer:GGTTGTAACAACGCACGGTTTAG Reverse Primer:CACCTTCTCTGAAAGCCGAGC Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:0.76 ng/ml Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0188126 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.