0 comments Details Genus:Sphaerothecum Species:destruens Common Name: Genbank Taxid: Group:parasite Habitat:Freshwater Status:Parasite Gene Region:18S Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:ACTTTGCGAATCGTATGACATTTTGTC Reverse Primer:CCACTACCTTACCATCGAAAGTTGA Probe:ACGATGATTCATTCAAATTTC PCR Efficiency:N/A R2: Limit of Detection:1 pg/l Limit of Quantification:N/A Journal:International Journal for Parasitology Source: https://www.sciencedirect.com/science/article/pii/S0020751918300195?via%3Dihub Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.