alligator snapping turtle 0 comments Details Genus:Macrochelys Species:temminckii Common Name:alligator snapping turtle Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Invasive Gene Region:CR Fragment Length:84 qPCR Chemistry:Probe Forward Primer:TTGTCGCCATATTTACGCCCTT Reverse Primer:TGAATGCACGATATACATAGGGTGGT Probe:tacTtcTctActGtgcacg PCR Efficiency:92.29 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Chelonian Conservation and Biology Source: https://doi.org/10.2744/CCB-1315.1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
