American bullfrog 0 comments Details Genus:Rana Species:catesbeiana Common Name:American bullfrog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:invasive Gene Region:16S Fragment Length:79 qPCR Chemistry:Probe Forward Primer:GCAGAGATAACCTCTCGT Reverse Primer:GTCCCATAGGACTGTTCT Probe:TGCCCTCCCGAAACTAAGTGAGC PCR Efficiency:76%-100% R2: Limit of Detection:none Limit of Quantification:N/A Journal:Biological Invasions Source: https://link.springer.com/article/10.1007%2Fs10530-019-01974-2 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
