Arctic char Details Genus:Salvelinus Species:alpinus Common Name:Arctic char Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:Fishery Gene Region:CYTB Fragment Length:145 qPCR Chemistry:Probe Forward Primer:CCGCCACAGTACTTCACCTTCTA Reverse Primer:AGGCCAAGCAATATAGCTACGAAA Probe:CCGACAAAATCTCATTCC PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Canadian Journal of Fisheries and Aquatic Sciences Source: https://doi.org/10.1139/cjfas-2017-0114 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast