Details

Platysternon megacephalum Big–Headed Turtle

Genus:

Platysternon

Species:

megacephalum

Common Name:

Big–Headed Turtle

Genbank Taxid:

55544

Group:

Reptile

Habitat:

Freshwater

Status:

Threatened

Gene Region:

ND4

Fragment Length:

83

qPCR Chemistry:

TaqMan

Forward Primer:

GCAAACACAAACTATGAGCGAAC

Reverse Primer:

GTCCCCATTAGTGGCAGGAA

Probe:

CGAACATTATTAATTGCC

PCR Efficiency:

94.15

R2:

0.97

Limit of Detection:

Limit of Quantification:

Journal:

Conservation Genetics Resources