Details

Mylopharyngodon piceus Black carp

Genus:

Mylopharyngodon

Species:

piceus

Common Name:

Black carp

Genbank Taxid:

75356 

Group:

Fish

Habitat:

Freshwater

Status:

Invasive

Gene Region:

ND2

Fragment Length:

120

qPCR Chemistry:

TaqMan

Forward Primer:

CGGAGGATGAGGGGGACTAA

Reverse Primer:

GCGACTAGGGTGAGTTGTGG

Probe:

GCTTACTCCTCAATCGCCCA

PCR Efficiency:

99.8–117.2

R2:

Limit of Detection:

3–4 copies / qPCR

Limit of Quantification:

16 copies / qPCR

Journal:

Transactions of the American Fisheries Society