Black carp 0 comments Details Mylopharyngodon piceus Black carp Genus: Mylopharyngodon Species: piceus Common Name: Black carp Genbank Taxid: 75356 Group: Fish Habitat: Freshwater Status: Invasive Gene Region: CO3 Fragment Length: 100 qPCR Chemistry: TaqMan Forward Primer: ACAAGCTATCCAATCCCTTGCA Reverse Primer: GTCTGCGATTGTAAAGGGTGC Probe: ACTGGGACTTTACTTCACTGCT PCR Efficiency: 96.5–102.8 R2: – Limit of Detection: LOD: 3 copies / qPCR, Multiplex LOD: 10 copies / qPCR Limit of Quantification: LOQ: 64 copies / qPCR, Multiplex LOQ: 10 copies / qPCR Journal: Transactions of the American Fisheries Society Source: Guan et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.