Details

Mylopharyngodon piceus Black carp

Genus:

Mylopharyngodon

Species:

piceus

Common Name:

Black carp

Genbank Taxid:

75356 

Group:

Fish

Habitat:

Freshwater

Status:

Invasive

Gene Region:

CO3

Fragment Length:

100

qPCR Chemistry:

TaqMan

Forward Primer:

ACAAGCTATCCAATCCCTTGCA

Reverse Primer:

GTCTGCGATTGTAAAGGGTGC

Probe:

ACTGGGACTTTACTTCACTGCT

PCR Efficiency:

96.5–102.8

R2:

–

Limit of Detection:

LOD: 3 copies / qPCR, Multiplex LOD: 10 copies / qPCR

Limit of Quantification:

LOQ: 64 copies / qPCR, Multiplex LOQ: 10 copies / qPCR

Journal:

Transactions of the American Fisheries Society