Details

Acanthopagrus schlegelii Blackhead seabream

Genus:

Acanthopagrus

Species:

schlegelii

Common Name:

Blackhead seabream

Genbank Taxid:

72011

Group:

Fish

Habitat:

Marine

Status:

Fishery

Gene Region:

Cytb

Fragment Length:

129

qPCR Chemistry:

TaqMan

Forward Primer:

CTGTCTGCCGTCCCCTACA

Reverse Primer:

TATGGCGGCTACGATAAAAGGA

Probe:

FAM–TCAGTTGACAACGCAACCCTAACCCG–TAMRA

PCR Efficiency:

0.79–0.87

R2:

0.98–0.99

Limit of Detection:

Limit of Quantification:

Journal:

PLOS One