Blackhead seabream 0 comments Details Acanthopagrus schlegelii Blackhead seabream Genus: Acanthopagrus Species: schlegelii Common Name: Blackhead seabream Genbank Taxid: 72011 Group: Fish Habitat: Marine Status: Fishery Gene Region: Cytb Fragment Length: 129 qPCR Chemistry: TaqMan Forward Primer: CTGTCTGCCGTCCCCTACA Reverse Primer: TATGGCGGCTACGATAAAAGGA Probe: FAM–TCAGTTGACAACGCAACCCTAACCCG–TAMRA PCR Efficiency: 0.79–0.87 R2: 0.98–0.99 Limit of Detection: – Limit of Quantification: – Journal: PLOS One Source: Takahashi et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.