Brazilian elodea 0 comments Details Egeria densa Brazilian elodea Genus: Egeria Species: densa Common Name: Brazilian elodea Genbank Taxid: 55453 Group: Plant Habitat: Freshwater Status: Invasive Gene Region: ITS1–5.8s–ITS2 Fragment Length: 79 qPCR Chemistry: TaqMan Forward Primer: 5′–GGTCAATGGCAATTCCTTCTTG–3′ Reverse Primer: 5′–GCGCACCACCCAAATAGA–3′ Probe: 6FAM–5′–CCATGCCCAATGAGAGTCGCGTAT–3′ PCR Efficiency: 96.25 R2: 0.99 Limit of Detection: 2.29 copy/qPCR Limit of Quantification: 4.68 copy/qPCR Journal: Conservation Genetics Resources Source: Chase et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.