Details

Egeria densa Brazilian elodea

Genus:

Egeria

Species:

densa

Common Name:

Brazilian elodea

Genbank Taxid:

 55453

Group:

Plant

Habitat:

Freshwater

Status:

Invasive

Gene Region:

ITS1–5.8s–ITS2

Fragment Length:

79

qPCR Chemistry:

TaqMan

Forward Primer:

5′–GGTCAATGGCAATTCCTTCTTG–3′

Reverse Primer:

5′–GCGCACCACCCAAATAGA–3′

Probe:

6FAM–5′–CCATGCCCAATGAGAGTCGCGTAT–3′

PCR Efficiency:

96.25

R2:

0.99

Limit of Detection:

2.29 copy/qPCR

Limit of Quantification:

4.68 copy/qPCR

Journal:

Conservation Genetics Resources