Details

Coregonus nasus broad whitefish

Genus:

Coregonus

Species:

nasus

Common Name:

broad whitefish

Genbank Taxid:

348707

Group:

Fish

Habitat:

Freshwater

Status:

Gene Region:

COI or cytb?

Fragment Length:

146

qPCR Chemistry:

TaqMan

Forward Primer:

TCGATCCCTAACAAACTAGGC

Reverse Primer:

TCTGCTACTAGGGTTCAGAATAGGAA

Probe:

FAM‐TATTCTACACACCTCTAAGCAG‐MGB‐NFQ

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Methods in Ecology and Evolution