broad whitefish 0 comments Details Coregonus nasus broad whitefish Genus: Coregonus Species: nasus Common Name: broad whitefish Genbank Taxid: 348707 Group: Fish Habitat: Freshwater Status: Gene Region: COI or cytb? Fragment Length: 146 qPCR Chemistry: TaqMan Forward Primer: TCGATCCCTAACAAACTAGGC Reverse Primer: TCTGCTACTAGGGTTCAGAATAGGAA Probe: FAM‐TATTCTACACACCTCTAAGCAG‐MGB‐NFQ PCR Efficiency: – R2: – Limit of Detection: – Limit of Quantification: – Journal: Methods in Ecology and Evolution Source: Rodgers et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.