brook trout #2 0 comments Details Genus:Salvelinus Species:fontinalis Common Name:brook trout #2 Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:CYTB Fragment Length:approx. 150 qPCR Chemistry:Probe Forward Primer:CCACAGTGCTTCACCTTCTATTTCTA Reverse Primer:GCCAAGTAATATAGCTACAAAACCTAATAGATC Probe:ACTCCGACGCTGACAA PCR Efficiency:92.24 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLOS ONE Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3608683/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.