brook trout 0 comments Details Genus:Salvelinus Species:fontinalis Common Name:brook trout Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:Fishery Gene Region:CYTB Fragment Length:90 qPCR Chemistry:Probe Forward Primer:CCATGAGGGCAAATATCCTTCTGA Reverse Primer:TCATTGTACAAGGGCACCTCCTA Probe:CTCCTCTCTGCTGTACCC PCR Efficiency:90.4%-101.1% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12285 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
