Brown trout 0 comments Details Genus:Salmo Species:trutta Common Name:Brown trout Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:CYTB Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:CGCCCGAGGACTCTACTATGGT Reverse Primer:GGAAGAACGTAGCCCACGAA Probe:CGGAGTCG TACTGCTAC PCR Efficiency:99.1 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-016-0548-5 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
