Brown trout Details Genus:Salmo Species:trutta Common Name:Brown trout Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:native Gene Region:COI Fragment Length:61 qPCR Chemistry:Probe Forward Primer:TTTTGTTTGGGCCGTGTTAGT Reverse Primer:TGCTAAAACAGGGAGGGAGAGT Probe:ACCGCCGTCCTCT PCR Efficiency:93 R2: Limit of Detection:0⋅1 pg μl-1 Cq=38 Limit of Quantification:N/A Journal:Journal of Fish Biology Source: http://doi.wiley.com/10.1111/jfb.12781 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast