Bryozoan 0 comments Details Genus:Bugula Species:neritina Common Name:Bryozoan Genbank Taxid: Group: Habitat:marine Status:invasive Gene Region:COI Fragment Length:185 qPCR Chemistry:Probe Forward Primer:GGTACATTATACTTTTTATTTGGAC Reverse Primer:CCCCCAATTATAACTGGTATG Probe:CCAGGCAGCTTATTAGGTAACGACCA PCR Efficiency:104 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Marine Environmental Research Source: http://linkinghub.elsevier.com/retrieve/pii/S0141113618301259 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
