Details

Genus:

Python

Species:

molurus bivittatus

Common Name:

Burmese Python

Genbank Taxid:

Group:

Reptile

Habitat:

Freshwater

Status:

Native

Gene Region:

ND4

Fragment Length:

146

qPCR Chemistry:

Probe

Forward Primer:

CACCCTAACAACTTCAATACCTCTACTAAT

Reverse Primer:

GAG GTT TGT TCA GTGGTT ATT TGT TTTCCTAACAACTTCAATACCTCTACTAAT

Probe:

CCA ACA CTA TTA TTCCTA GCA ACCCTAACAACTTCAATACCTCTACTAAT

PCR Efficiency:

1.0805

R2:

Limit of Detection:

8 X 10āˆ’6 ng/Ī¼L

Limit of Quantification:

N/A

Journal:

PLOS One