Cane Toad 0 comments Details Genus:Rhinella Species:marina Common Name:Cane Toad Genbank Taxid: Group:Amphibian Habitat:marine/freshwater Status:Invasive Gene Region:spanning part of the mitochondrial tRNA-Gly and NADH dehydroge- nase subunit 3 (ND3) genes Fragment Length:80 qPCR Chemistry:Probe Forward Primer:ACCCCAGGAGAAAATAATGTCTCT Reverse Primer:ACCAGAAGCTAACAGTGGCTAAAAT Probe:CAATTGCTAGGGTAATAAA PCR Efficiency:100 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Biological Invasions Source: https://link.springer.com/article/10.1007/s10530-018-1810-4 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
