Details

Oncorhynchus tshawytscha Chinook salmon

Genus:

Oncorhynchus

Species:

tshawytscha

Common Name:

Chinook salmon

Genbank Taxid:

74940

Group:

Fish

Habitat:

Anadromous

Status:

Threatened

Gene Region:

COIII/ND3

Fragment Length:

qPCR Chemistry:

TaqMan

Forward Primer:

CCTTTCTAGCCGTTTGCCTTCT

Reverse Primer:

CAGCTTCAAAGCCAAAATGATGTTC

Probe:

5’ FAMAGTGGTATTGAACTTGTCG–NFQ

PCR Efficiency:

R2:

Limit of Detection:

1.4e–6 µg / µL

Limit of Quantification:

Journal:

Biological Conservation