Chinook salmon 0 comments Details Oncorhynchus tshawytscha Chinook salmon Genus: Oncorhynchus Species: tshawytscha Common Name: Chinook salmon Genbank Taxid: 74940 Group: Fish Habitat: Anadromous Status: Threatened Gene Region: COIII/ND3 Fragment Length: – qPCR Chemistry: TaqMan Forward Primer: CCTTTCTAGCCGTTTGCCTTCT Reverse Primer: CAGCTTCAAAGCCAAAATGATGTTC Probe: 5’ FAMAGTGGTATTGAACTTGTCG–NFQ PCR Efficiency: – R2: – Limit of Detection: 1.4e–6 µg / µL Limit of Quantification: – Journal: Biological Conservation Source: Shelton et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.