Details

Oncorhynchus kisutch Coho

Genus:

Oncorhynchus

Species:

kisutch

Common Name:

Coho

Genbank Taxid:

8019

Group:

Fish

Habitat:

Anadromous

Status:

Threatened

Gene Region:

COIII/ND3

Fragment Length:

qPCR Chemistry:

TaqMan

Forward Primer:

CCTTTCTAGCCGTTTGCCTTCT

Reverse Primer:

CAGCTTCAAAGCCAAAATGATGTTC

Probe:

5’ VIC– AAGTGGTATTGGACCTGTCG–NFQ

PCR Efficiency:

R2:

Limit of Detection:

1.4e–6 µg / µL

Limit of Quantification:

Journal:

Biological Conservation