Details

Oncorhynchus kisutch Coho

Genus:

Oncorhynchus

Species:

kisutch

Common Name:

Coho

Genbank Taxid:

8019

Group:

Fish

Habitat:

Anadromous

Status:

Gene Region:

COI

Fragment Length:

95

qPCR Chemistry:

TaqMan

Forward Primer:

CGCTCTTCTAGGGGATGATC

Reverse Primer:

CTCCGATCATAATCGGCATG

Probe:

FAM‐ATTTACAACGTAATCGTC‐MGB

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Molecular Ecology Resources