Details

Rana luteiventris Columbia spotted frog

Genus:

Rana

Species:

luteiventris

Common Name:

Columbia spotted frog

Genbank Taxid:

58176

Group:

Amphibian

Habitat:

Freshwater

Status:

Gene Region:

Cytb

Fragment Length:

qPCR Chemistry:

QuantiTect Multiplex PCR Mix

Forward Primer:

TTCAATGAATCTGAGGAGGCTTTT

Reverse Primer:

GAAAGGAAGGATGAAGTGGAATGT

Probe:

6FAM–AGTAGACAATGCTACCCTC–MGB

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Ecography