common carp 0 comments Details Genus:Cyprinus Species:carpio Common Name:common carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:CYTB Fragment Length:78 qPCR Chemistry:Probe Forward Primer:GGTGGGTTCTCAGTAGACAATGC Reverse Primer:GGCGGCAATAACAAATGGTAGT Probe:CACTAACACGATTCTTCGCATTCCACTTCC PCR Efficiency:N/A R2: Limit of Detection:1 copy/reaction Limit of Quantification:N/A Journal:PLOS ONE Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0035868 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
