Common Carp 0 comments Details Genus:Cyprinus Species:carpio Common Name:Common Carp Genbank Taxid: Group:Fish Habitat:mesocosm Status:Native Gene Region:N/A Fragment Length:146 qPCR Chemistry:Dye Forward Primer:GAGTGCAGGCTCAAATGTTAAA Reverse Primer:GTAAGGATAAGTTGAACTAGAGACAG Probe:N/A PCR Efficiency:97.2 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Environmental Science & Technology Source: https://doi.org/10.1021/es404734p Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.