Common carp 0 comments Details Genus:Cyprinus Species:carpio Common Name:Common carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:D-loop Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:TCCACCCTCGGATAAT Reverse Primer:ACTATGTAAGGATAAGTTGAACTA Probe:GAGATGCCAGA PCR Efficiency:79 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://onlinelibrary.wiley.com/doi/abs/10.1111/1755-0998.12460 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.