common carp 0 comments Details Genus:Cyprinus Species:carpio Common Name:common carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:CYTB Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:GGTGGGTTCTCAGTAGACAATGC Reverse Primer:GGCGGCAATAACAAATGGTAGT Probe:CACTAACACGATTCTTCGCATTCCACTTCC PCR Efficiency:0.984 to 0.990 R2: Limit of Detection:one copy per reaction Limit of Quantification:N/A Journal:Limnology and Oceanography: Methods Source: https://doi.org/10.1002/lom3.10161 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
