common octopus 0 comments Details Genus:Octopus Species:vulgaris Common Name:common octopus Genbank Taxid: Group:Mollusk Habitat:marine Status:elusive Gene Region:COI Fragment Length:204 qPCR Chemistry:Conventional PCR Forward Primer:TGTTACAGCTCACGCATTTGTT Reverse Primer:CCGGTACCTGCACCTCTTTC Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Fisheries Research Source: https://doi.org/10.1016/j.fishres.2017.02.023 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
