dwarf wedgemussel 0 comments Details Genus:Alasmidonta Species:heterodon Common Name:dwarf wedgemussel Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Thretened/Endangered Gene Region:COI Fragment Length:277 qPCR Chemistry:Probe Forward Primer:CACACCCCTTTCAACCAACG Reverse Primer:GTTGGCTTTAAGACTTTTAATC Probe:TGGTCATCTCCTAACAACCTTCCAGG PCR Efficiency:96.5 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Aquatic Conservation: Marine and Freshwater Ecosystems Source: https://onlinelibrary-wiley-com.proxy.lib.umich.edu/doi/full/10.1002/aqc.3069 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
