Dwarf wedgemussel 0 comments Details Alasmidonta heterodon Dwarf wedgemussel Genus: Alasmidonta Species: heterodon Common Name: Dwarf wedgemussel Genbank Taxid: 85048 Group: Mollusk Habitat: Freshwater Status: Gene Region: COI Fragment Length: 277 qPCR Chemistry: 1X GoTaq® Probe qPCR® Master Mix Forward Primer: CACACCCCTTTCAACCAACG Reverse Primer: GTTGGCTTTAAGACTTTTAATC Probe: TGGTCATCTCCTAACAACCTTCCAGG PCR Efficiency: 0.965 R2: 0.99895 Limit of Detection: – Limit of Quantification: – Journal: Aquatic Conservation: Marine and Freshwater Ecosystems Source: Schill et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.