Details

Alasmidonta heterodon Dwarf wedgemussel

Genus:

Alasmidonta

Species:

heterodon

Common Name:

Dwarf wedgemussel

Genbank Taxid:

85048

Group:

Mollusk

Habitat:

Freshwater

Status:

Gene Region:

COI

Fragment Length:

277

qPCR Chemistry:

1X GoTaq® Probe qPCR® Master Mix

Forward Primer:

CACACCCCTTTCAACCAACG

Reverse Primer:

GTTGGCTTTAAGACTTTTAATC

Probe:

TGGTCATCTCCTAACAACCTTCCAGG

PCR Efficiency:

0.965

R2:

0.99895

Limit of Detection:

Limit of Quantification:

Journal:

Aquatic Conservation: Marine and Freshwater Ecosystems