eastern massasauga rattlesnake 0 comments Details Genus:Sistrurus Species:catenatus Common Name:eastern massasauga rattlesnake Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Threatened Gene Region:COI Fragment Length:137 qPCR Chemistry:Probe Forward Primer:CACTACTTCTCCTACTCTCCTC Reverse Primer:GGCCAAATGAAGGGAGAAA Probe:AACAGTTCATCCTGTCCCTGCGCC PCR Efficiency:N/A R2: Limit of Detection:1×10−8 ng/µ Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-018-1053-9 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.