eastern pondmussel 0 comments Details Genus:Ligumia Species:nasuta Common Name:eastern pondmussel Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Threatened Gene Region:COI Fragment Length:102 qPCR Chemistry:Probe Forward Primer:GGTTTGGCTCTAAGTCTTTTAATTCG Reverse Primer:GAAAGCATGCGCTGTCACAA Probe:TGGGACAACCTGGTAGAT PCR Efficiency:??? R2: Limit of Detection:10 copies per 5 μL Limit of Quantification:N/A Journal:Wiley Source: https://onlinelibrary.wiley.com/doi/abs/10.1002/aqc.2869 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
