Details

Genus:

Ligumia

Species:

nasuta

Common Name:

eastern pondmussel

Genbank Taxid:

Group:

Mollusc

Habitat:

Freshwater

Status:

Threatened

Gene Region:

COI

Fragment Length:

102

qPCR Chemistry:

Probe

Forward Primer:

GGTTTGGCTCTAAGTCTTTTAATTCG

Reverse Primer:

GAAAGCATGCGCTGTCACAA

Probe:

TGGGACAACCTGGTAGAT

PCR Efficiency:

???

R2:

Limit of Detection:

10 copies per 5 ΞΌL

Limit of Quantification:

N/A

Journal:

Wiley