Details

Ammocrypta pellucida Eastern sand darter

Genus:

Ammocrypta

Species:

pellucida

Common Name:

Eastern sand darter

Genbank Taxid:

105258

Group:

Fish

Habitat:

Freshwater

Status:

Rare species

Gene Region:

COI

Fragment Length:

83

qPCR Chemistry:

TaqMan

Forward Primer:

5′‐CTTGTTCGTGTGGGCTGTGTT‐3′

Reverse Primer:

5′‐GCAAGAACTGGGAGCGAAAG‐3′

Probe:

5′‐6FAM‐ATTACCGCTGTTCTTC‐3′

PCR Efficiency:

92–113

R2:

Limit of Detection:

1 copy / reaction

Limit of Quantification:

10 copies / reaction

Journal:

Journal of Applied Ichthyology