Details

Platalea leucorodia Eurasian spoonbill

Genus:

Platalea

Species:

leucorodia

Common Name:

Eurasian spoonbill

Genbank Taxid:

257867

Group:

Bird

Habitat:

Status:

Protected

Gene Region:

COI

Fragment Length:

160

qPCR Chemistry:

SYBR Green

Forward Primer:

CTATTCGTTTGATCAGTCCTAATCACTG

Reverse Primer:

AAAATAGATGTTGGTATAAGACAGGGTC

Probe:

PCR Efficiency:

1.82

R2:

1

Limit of Detection:

40.31 Ct, 0.01 pg μl − 1

Limit of Quantification:

Journal:

Conservation Genetics Resources