European noble crayfish 0 comments Details Astacus astacus European noble crayfish Genus: Astacus Species: astacus Common Name: European noble crayfish Genbank Taxid: 6715 Group: Crusteacean Habitat: Freshwater Status: Gene Region: COI Fragment Length: 65 qPCR Chemistry: TaqMan Forward Primer: GATTAGAGGAATAGTAGAGAG Reverse Primer: CTGATGCTAAAGGGGGATAA Probe: FAM‐AGGAGTAGGGACAGGATGAACT‐BHQ1 PCR Efficiency: – R2: – Limit of Detection: – Limit of Quantification: – Journal: Journal of Applied Ecology Source: Strand et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.