Details

Misgurnus fossilis European weather loach

Genus:

Misgurnus

Species:

fossilis

Common Name:

European weather loach

Genbank Taxid:

7984

Group:

Fish

Habitat:

Freshwater

Status:

Least concern; Population decreasing

Gene Region:

COI

Fragment Length:

119

qPCR Chemistry:

Bio‐Rad SsoAdvanced Universal Probes Supermix

Forward Primer:

CCCCCGACATAGCATTTCCG

Reverse Primer:

AACTGTTCAGCCTGTCCCAG

Probe:

(6‐FAM)CTCGTTCCTCCTTCTGCTGG(ZEN/IBFQ)

PCR Efficiency:

R2:

Limit of Detection:

0.07 copies μl–1

Limit of Quantification:

0.14 copies μl–1

Journal:

Journal of Fish Biology