European weather loach 0 comments Details Misgurnus fossilis European weather loach Genus: Misgurnus Species: fossilis Common Name: European weather loach Genbank Taxid: 7984 Group: Fish Habitat: Freshwater Status: Least concern; Population decreasing Gene Region: COI Fragment Length: 119 qPCR Chemistry: Bio‐Rad SsoAdvanced Universal Probes Supermix Forward Primer: CCCCCGACATAGCATTTCCG Reverse Primer: AACTGTTCAGCCTGTCCCAG Probe: (6‐FAM)CTCGTTCCTCCTTCTGCTGG(ZEN/IBFQ) PCR Efficiency: – R2: – Limit of Detection: 0.07 copies μl–1 Limit of Quantification: 0.14 copies μl–1 Journal: Journal of Fish Biology Source: Brys et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.