Details

Etheostoma flabellare Fantail Darter

Genus:

Etheostoma

Species:

flabellare

Common Name:

Fantail Darter

Genbank Taxid:

54330

Group:

Fish

Habitat:

Freshwater

Status:

Gene Region:

Cytb

Fragment Length:

118

qPCR Chemistry:

TaqMan

Forward Primer:

AAGCGAAGAAGCGAGTTAGG

Reverse Primer:

GGTGCTACGGTCATCACTAATC

Probe:

FAM–CCCACATAA/ZEN/GGCACTGCAGAGAGT/3IABkFQ

PCR Efficiency:

97.2

R2:

Limit of Detection:

Limit of Quantification:

Journal:

International Journal of Zoology