Flatwoods salamander 0 comments Details Genus:Ambystoma Species:cingulatum/bishopi Common Name:Flatwoods salamander Genbank Taxid: Group:Amphibian Habitat:freshwater Status:endangered/threatened Gene Region:N/A Fragment Length:132 qPCR Chemistry:Probe Forward Primer:GGCCCGTCAACTTTCCTCTAA Reverse Primer:TGGTCCAGGTAAATCAATTGCA Probe:TACGGTAATATGTCTGGTACTAC PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal of Fish and Wildlife Managment Source: http://www.fwspubs.org/doi/abs/10.3996/042014-JFWM-034 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
