Gizzard shad 0 comments Details Genus:Dorosoma Species:cepedianum Common Name:Gizzard shad Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:Fishery Gene Region:ND4 Fragment Length:101 qPCR Chemistry:Probe Forward Primer:ACTAGTCACTGTGTCGTGG Reverse Primer:TCCTCTATTCGGCTCATTCC Probe:TGCCATCCT/ZEN/TGTTCTTCTGAC PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:North American Journal of Fisheries Management Source: http://doi.wiley.com/10.1080/02755947.2017.1342721 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
